View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20293_low_10 (Length: 295)
Name: NF20293_low_10
Description: NF20293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20293_low_10 |
 | |
|
| [»] scaffold1333 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold1333 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 1111 - 1177
Alignment:
| Q |
1 |
ttggaactcaaagagaaactatatttattttgtgagattatggaagatgagtacacaataaatttat |
67 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1111 |
ttggaactcaaagaggaactatatttattttgtgagattatggaagatgagtacacaataaatttat |
1177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 241 - 280
Target Start/End: Original strand, 1226 - 1265
Alignment:
| Q |
241 |
ccatcactattttgcattttaattcgcttattgaacttca |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1226 |
ccatcactattttgcattttaattcgcttattgaacttca |
1265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 1174 - 1214
Alignment:
| Q |
168 |
ttatctgacacatggtttaatctgtgtcttttaagaagcat |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1174 |
ttatctgacacatggtttaatctctgtcttttaagaagcat |
1214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University