View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20293_low_5 (Length: 431)
Name: NF20293_low_5
Description: NF20293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20293_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 178 - 420
Target Start/End: Complemental strand, 49081983 - 49081741
Alignment:
| Q |
178 |
gtggacgaagaagcaaacaaaagagaatagttttttcaaactactttaaatgcttaatagccgccttacagccacgaaaactaaatatcttattgctttc |
277 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49081983 |
gtggaggaagaagaaaacaaaagagaatagttttttcaaactactttaaatgcttaatagccgccttacagccacgaaaactaaatatcttattgctttc |
49081884 |
T |
|
| Q |
278 |
tttgtttttgtggtttcagattcaaccagatctatttctcttctctccgcttccttcattcattcctttgtctttactctttgctcacgtgcctcctttt |
377 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49081883 |
tttgtttttgtggtctcagattcaaccagatctatttctcttctctccgcttccttcattcattcctttgtctttactctttgctcacgtgcctcctttt |
49081784 |
T |
|
| Q |
378 |
ccaccatccatttcacccttctgggaccaacacgtgcctctct |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49081783 |
ccaccatccatttcacccttctgggaccaacacgtgcctctct |
49081741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 18 - 149
Target Start/End: Complemental strand, 49082124 - 49081997
Alignment:
| Q |
18 |
aaatgatagtaaattaattgaatggaaaacaaaaaccgcatcaacaaacaagagaacgaaatcgtatgtatgtatctgttagttagctggagtcttaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49082124 |
aaatgatagtaaattaattgaatggaaaacaaaaaccgcatcaacaaacaagagaacgaaatcgtat----gtatctgttagttagctggagtcttaagt |
49082029 |
T |
|
| Q |
118 |
aagtaagttgaatgaatataacaaaatatctg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49082028 |
aagtaagttgaatgaatataacaaaatatctg |
49081997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University