View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20293_low_6 (Length: 390)
Name: NF20293_low_6
Description: NF20293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20293_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 16798254 - 16798296
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcacccgataaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
16798254 |
tgcacccttaaaaatagggaccatattaggggcaccccataaa |
16798296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 16797436 - 16797400
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16797436 |
tgcacccttaaaaatagggaccatgttagaggcaccc |
16797400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 50638002 - 50637965
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcacccg |
38 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50638002 |
tgcacccttaaaaatagggaccatgttagaggcacccg |
50637965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 50638820 - 50638857
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcacccg |
38 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50638820 |
tgcacccttaaaaatagggaccatattaggggcacccg |
50638857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 98418 - 98454
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
98418 |
tgcacccttaaaaatagggaccatattaggggcaccc |
98454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 37
Target Start/End: Complemental strand, 97654 - 97621
Alignment:
| Q |
4 |
acccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
97654 |
acccttaaaaatagggaccatattaggggcaccc |
97621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 24948434 - 24948398
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24948434 |
tgcacccttaaaaatagggaccatattagaagcaccc |
24948398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 24949216 - 24949253
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcacccg |
38 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
24949216 |
tgcacccttaaaaatagggaccatattagggccacccg |
24949253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 40828817 - 40828781
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40828817 |
tgcacccttaaaaatagggaccatattagatgcaccc |
40828781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 40829594 - 40829630
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40829594 |
tgcacccttaaaaatagggaccatattaggggcaccc |
40829630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 11744101 - 11744065
Alignment:
| Q |
1 |
tgcacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11744101 |
tgcacccttaaaaatagggaccatattaggggcaccc |
11744065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 37
Target Start/End: Original strand, 11744882 - 11744916
Alignment:
| Q |
3 |
cacccttaaaaatagggaccatattagaggcaccc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
11744882 |
cacccttaaaaatagggaccatattagaagcaccc |
11744916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University