View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20293_low_8 (Length: 323)
Name: NF20293_low_8
Description: NF20293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20293_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 11 - 307
Target Start/End: Complemental strand, 6394487 - 6394191
Alignment:
| Q |
11 |
caaaggaatgaacaattttaaaagggnnnnnnntaattttctttttacgtatgtgttgttgttttgaattatgattcaaattccaactaagagaacatgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6394487 |
caaaggaatgaacaattttaaaagggaaaaaaataatttcctttttacatatgtgttgttgttttgaattatgattcaaattccaactaagagaacatgt |
6394388 |
T |
 |
| Q |
111 |
gtttggatcacatggcccccactgtctcattttaagagaacattcacaaccaaaatgtgtttccttacattctgtagagttgctttctgctggttcataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6394387 |
gtttggatcacatggcccccactgtctcattttaagagaacattcacaaccaaaatgtgtttccttacattctgtagagttgctttctgctggttcataa |
6394288 |
T |
 |
| Q |
211 |
tatgttgttgtttgtctgttctttagttgattgttttgaatttggtgacggttgctttaaatggatttggattttggtttcacaagctagttgtttc |
307 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6394287 |
tatgttgttgtttgtctgttcttttgctgattgttttgaatttggtgacggttgctttaaatggatttggattttggtttcacaagctagttgtttc |
6394191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University