View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_high_10 (Length: 269)
Name: NF20294_high_10
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 6635436 - 6635661
Alignment:
| Q |
16 |
attgtactagaactattaaaattaacaatagagctttatccgtttggaacaatggtgtcgctttaatattagtcctcttaacatttttcannnnnnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6635436 |
attgtactagaactattaaaattaacaatagaactttatccgtttggaacaatggtgtcactttaatattagtcctcttaacatttttcatttttttt-- |
6635533 |
T |
 |
| Q |
116 |
cttcatttctttaatatcagtcccctcgacatttttcatttctaacacatcatatgtcataacacaaaagtcatcacatggactataaattaatatcctc |
215 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635534 |
cttcatttctttaatatcagtctcctagacatttttcatttctaacacatcaaatgtcataacacaaaagtcatcacatggactataaattaatatcctc |
6635633 |
T |
 |
| Q |
216 |
atttgcgccaccaatatttctttccaac |
243 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
6635634 |
atttgcgccactaatatttctttccaac |
6635661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University