View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_high_5 (Length: 367)
Name: NF20294_high_5
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 21 - 355
Target Start/End: Original strand, 15816921 - 15817259
Alignment:
| Q |
21 |
aggggttgtgaggtctcaagtggttgctaaccctagctggaaacgaccgctgaaattgggtgaagatttcagaccattaacaaaattgtcatcatcctag |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15816921 |
aggggttgtgaggtctcaaatggttgctaaccctagctggaaacgaccgctgaaattgggtgaagatttcagaccattaacaacattgtcatcatcctag |
15817020 |
T |
 |
| Q |
121 |
tacaagtcttatctctac---ccaagttattccctttgataattttccatgtgaagtgtcctagtcttatcctttgggaatctcatattccttgtccttt |
217 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15817021 |
tacaagtcttgtctatacgtcccaagttattccctttgataattttccatgtgaggtgtcctagtcttatcctttgggaatctcatattccttatccttt |
15817120 |
T |
 |
| Q |
218 |
ctagtattgctaaccattggtgattcatggagcttcgtttgcaagtatcactattgatagacccacgttttacaattgtactaggtaccgg-ttatcata |
316 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15817121 |
ccagtattgctaaccattggtgattcatggagcttcgtttgcaagtatcactattgatggacccacgttttacaattgtactaggtaccggtttatcata |
15817220 |
T |
 |
| Q |
317 |
ccgcaacttcaaatttaatttaaataccatgccaatatt |
355 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15817221 |
ctgcaacttcaaatttaatttaaataccatgccaatatt |
15817259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 51
Target Start/End: Original strand, 15833433 - 15833463
Alignment:
| Q |
21 |
aggggttgtgaggtctcaagtggttgctaac |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15833433 |
aggggttgtgaggtctcaagtggttgctaac |
15833463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 23 - 95
Target Start/End: Complemental strand, 1903146 - 1903073
Alignment:
| Q |
23 |
gggttgtgaggtctcaagtggttgctaaccctagctggaaacgaccgctgaaattgggtga-agatttcagacc |
95 |
Q |
| |
|
||||| |||| ||| |||||| |||||||||||| |||||||||||||| ||||||| ||| | |||||||||| |
|
|
| T |
1903146 |
gggttctgagatcttaagtggctgctaaccctagttggaaacgaccgcttaaattggatgacaaatttcagacc |
1903073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University