View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_low_12 (Length: 243)
Name: NF20294_low_12
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 38931793 - 38932006
Alignment:
| Q |
14 |
ataatactaagacctcctttaacatgtataatttggtgctttctatgttcttcatctggagattgaagctttctaattatactttctttcactttcaaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931793 |
ataatactaagacctcctttaacatgtataatttggtgctttctatgttgttcatcttgagattgaagctttctaattatactttctttcactttcaaaa |
38931892 |
T |
 |
| Q |
114 |
cttgtcccaagaaacgtgaatcaaaaccactgaacatgttgttagtttcttcttctttatcaccacgctttctaccactctgttttactggattcccagc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38931893 |
cttgtcccaagaaacgtgaatcaaaaccactgaacatgttgttagtttcttcttctttatcaccacgctttcttccactctgttttactggattcccagc |
38931992 |
T |
 |
| Q |
214 |
tagataaaatctct |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38931993 |
tagataaaatctct |
38932006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University