View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_low_13 (Length: 237)
Name: NF20294_low_13
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 39651774 - 39651544
Alignment:
| Q |
1 |
cacctcctggtgcacttggtttaaacaatcttgtcaatccatacggtgttagatatcctgctgctgcaacgagactttcatccagaagaaacggttatgg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39651774 |
cacctcctggtgcacttagtttaaacaatcttgtcaatccatacggtgttagatatcctgctgctgcaacgagactttcatccagaagaaatggttatgg |
39651675 |
T |
 |
| Q |
101 |
acaagatggtgcttggatcgctaatacatttaactcattgctcacacaaccaaactatagtcaaacacttggaactcaactaccttatcagtcaaataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39651674 |
acaagatggtgcttggatcgctaatacatttaactcattgctcacacaaccaaactatagtcaaacacttggaactcaactaccttatcagtcaaataat |
39651575 |
T |
 |
| Q |
201 |
aatctccagggtaatgcaaagaagtctagta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39651574 |
aatctccagggtaatgcaaagaagtctagta |
39651544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 162
Target Start/End: Complemental strand, 39661465 - 39661430
Alignment:
| Q |
127 |
catttaactcattgctcacacaaccaaactatagtc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39661465 |
catttaactcattgctcacacaaccaaactatagtc |
39661430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University