View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_low_14 (Length: 232)
Name: NF20294_low_14
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 46718125 - 46718327
Alignment:
| Q |
13 |
attatactgatggaaggtgtaactgctatatgcatgtatgcgaataccattgtcatccctaatcaaaaccaatgcatggttgtgcggtaagnnnnnnntc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46718125 |
attatactgatggaaggtgtaactgctatatgcatgtatgcgaataccattgtcatccctaatcaaaaccaatgcatggttgtgcggtaagaaaaaaatc |
46718224 |
T |
|
| Q |
113 |
acacaaaaatcttgttatgtctttaaataagggaaagaaaaaatgatgacacaatgcgtgccaaaaacttcaatgctattagtgtttaccaaagtcgttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46718225 |
acacaaaaatcttgttatgtctttaaataagggaaagaaaaaatgatgacacaatgcgtgccaaaaacttcaatgctattggtgtttaccaaagtcgttt |
46718324 |
T |
|
| Q |
213 |
act |
215 |
Q |
| |
|
||| |
|
|
| T |
46718325 |
act |
46718327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University