View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_low_15 (Length: 232)
Name: NF20294_low_15
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 3 - 232
Target Start/End: Complemental strand, 39652260 - 39652031
Alignment:
| Q |
3 |
aagaatatcaggcctttcagcagattttagagaatgaactgtcctcactaaattctatagtaaataatcaggtctctaggtcaaccgaaacaaatccact |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39652260 |
aagaaaatcaggcctttcagcagattttagagaatgaactgtcgtcactaaattctatagtaaataatcaggtctctaggtcaaccgaaacaaatccact |
39652161 |
T |
 |
| Q |
103 |
tgccggaaatcccttgcctcaatatcaggcctctcggccgattacaatggatgcaatgaatgcattgtcctcactgcgttctagaatacagaatcagata |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39652160 |
tgccggaaatcccttgcctcaatatcaggcctctcagccgattacaatggatgcaatgaatgcattgtcctcactgcgttctagaatacagaatcagata |
39652061 |
T |
 |
| Q |
203 |
tccacgcaaaataatgtccctgcattcgcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39652060 |
tccacgcaaaataatgtccctgcattcgcc |
39652031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University