View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20294_low_9 (Length: 276)
Name: NF20294_low_9
Description: NF20294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20294_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 2992975 - 2992722
Alignment:
| Q |
17 |
agtaccccgccttcactaattagagatgggatttcaagcataagtgttatcttttttattcaaatagttagtgacagattatttatctttgtgacgggtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2992975 |
agtaccccgccttcactaattagagatgggatttcaagcataagtgttatcttttttattcaaatagttagtgacagattatttatctttgtgacgggtt |
2992876 |
T |
 |
| Q |
117 |
taatgtcgtcgcaattagtgtctgattaattataattccctcaagaacactctgtgagaggttcaaattggttatagatttgtgatcatcattaaattcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
2992875 |
taatgtcgtcgcaattagtgtctgattaattataattccctcaagaacactctgtgagaggttcaaattggttatagatttgtggtcgtcattaaattca |
2992776 |
T |
 |
| Q |
217 |
tcgctaaaattctgtggcagaattttaacatgttagagatggatttcttctctc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2992775 |
tcgctaaaattctgtggcagaattttaacatgttagcgatggatttcttctctc |
2992722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University