View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20295_high_7 (Length: 310)
Name: NF20295_high_7
Description: NF20295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20295_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 16011643 - 16011367
Alignment:
| Q |
19 |
ttactctctaccaagaatttagtatcgccaccaaaacaaggttcagccaccaaatgagcagtcaagtctgattcgatcatcacagtctgaccggttcgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||| ||||||||| || |
|
|
| T |
16011643 |
ttactctctaccaagaatttagtatcgccaccaaaacaaggttcagccgccaaatgaacagtcaagtctgattcgatcatcatagtccgaccggttctat |
16011544 |
T |
 |
| Q |
119 |
ctattacacaaggcctccctttaaaattgaaaatatctccatgcgacttttccacatttgggacatcggggatatttgtccagtgatcatctccgcgatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||| ||||||||||| |||||||| |||| | | |
|
|
| T |
16011543 |
ctattacacaaggcctccctttaaaattgcaaatatctccatgtgatttttccacatttgggacatcgggcatatttgtccaatgatcatccccgcaacg |
16011444 |
T |
 |
| Q |
219 |
gaaaatcatcggctcaccagagtactcgcatgtgacaatatctagaagttgttccccgacaccgaggacctttctag |
295 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
16011443 |
gaaaataattagctcaccagagtactcgcatgtgacaatagctagaggttgttccccgacaccgataacctttctag |
16011367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University