View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20295_low_6 (Length: 361)
Name: NF20295_low_6
Description: NF20295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20295_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 208 - 350
Target Start/End: Original strand, 21702961 - 21703098
Alignment:
| Q |
208 |
ttctttaatgttagattttgtgtgtgtcaaactttgattattttttcctcataatctaacaactaaacaaccctaactattcacgtgtttgataaatatt |
307 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21702961 |
ttctttaatgttagattttgcgtgtgtcaaactttgatt--tttttcctcataatctaacaactaaacaaccctaactattcacatgtttgataaatatt |
21703058 |
T |
|
| Q |
308 |
tgacttataactatgcacatgattctattgttaggcttccttt |
350 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21703059 |
tgac---taactatgcacatgattgtattgttaggcttccttt |
21703098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 342
Target Start/End: Complemental strand, 21716450 - 21716411
Alignment:
| Q |
300 |
taaatatttgacttataactatgcacatgattctattgttagg |
342 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21716450 |
taaatatttgact---aactatgcacatgattctattgttagg |
21716411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University