View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_high_56 (Length: 242)
Name: NF20296_high_56
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_high_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 41720133 - 41720337
Alignment:
| Q |
19 |
ataaaaaacatcagagacaaactttagcataattcaaggactaagatttttacctgtaagaattgtatccctcttgaagcataaacagaacaaataggct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720133 |
ataaaaaacatcagagacaaactttagcataattcaaggactaagatttttacctgtaagaattgtatccctcttgaagcataaacagaacaaataggct |
41720232 |
T |
|
| Q |
119 |
ctgacagaacaaaagcagcgagatcctcgaatgtgagaccgaacatcacaacggttctcaacaccagaaacaaaaaacacgaaaacaaaccaatatcctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41720233 |
ctgacagaacaaaagcagcgagatcctcgaatgtgagaccgaacatcacaacggttctcaacaccagaaacaaaaaacacgaaaacaaaccaatatcctc |
41720332 |
T |
|
| Q |
219 |
agaac |
223 |
Q |
| |
|
||||| |
|
|
| T |
41720333 |
agaac |
41720337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University