View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_high_60 (Length: 238)
Name: NF20296_high_60
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_high_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 42392419 - 42392630
Alignment:
| Q |
11 |
caaaggcctgtccggtgttcgactcagtcacaacattcgtcacatctgattacattcaattatgtcattttctgtgtcaatgtcgtgtatggtgtctacg |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42392419 |
caaaggcgtgtccggtgttcgactcagtcacaacatttgtcacatctgattacattcaattatgttattttctgtgtcaatgtcgtgtatggtgtctacg |
42392518 |
T |
 |
| Q |
111 |
tgtgcttcatagcttctaaatcattttgtaaagtgtaaagttgttttaaactcttcataattgtttaataatattcggattgtatcagaacttaatgttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392519 |
tgtgcttcatagcttctaaatcattttgtaaagtgtaaagttgttttaaactcttcataattgtttaataatattcggattgtatcagaacttaatgttt |
42392618 |
T |
 |
| Q |
211 |
ttatatgaaaca |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42392619 |
ttatatgaaaca |
42392630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 13709236 - 13709204
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
13709236 |
cacatctgattacattcaattttgtcattttct |
13709204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 83
Target Start/End: Original strand, 8917545 - 8917577
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8917545 |
cacatctgattacattcaattatgtcattttct |
8917577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Original strand, 8917249 - 8917281
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
8917249 |
cacatctgattacattcaattatgttattttct |
8917281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 32691793 - 32691761
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
32691793 |
cacatgtgattacattcaattatgtcattttct |
32691761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 83
Target Start/End: Original strand, 10335385 - 10335417
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10335385 |
cacatctgattacattcaattatgtcattttct |
10335417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Original strand, 10893878 - 10893910
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
10893878 |
cacatgtgattacattcaattatgtcattttct |
10893910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 7512249 - 7512217
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
7512249 |
cacatctgattacattcaataatgtcattttct |
7512217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 683102 - 683070
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
683102 |
cacatgtgattacattcaattatgtcattttct |
683070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Original strand, 9988708 - 9988740
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
9988708 |
cacatgtgattacattcaattatgtcattttct |
9988740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 1502624 - 1502592
Alignment:
| Q |
51 |
cacatctgattacattcaattatgtcattttct |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
1502624 |
cacatgtgattacattcaattatgtcattttct |
1502592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University