View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_low_37 (Length: 318)
Name: NF20296_low_37
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 5696436 - 5696739
Alignment:
| Q |
1 |
cctaattaactttgtagagttcgtgcaatagttttattgaatcttaaaggttattaagtattt-cattgaatctaatttatttttacaatgcataggtgc |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5696436 |
cctaattaactttgtagagttcatgcaatagttttattgaatcttaaaggttattaagtatttacattgaatctaatttatttttacaatgcttaggtgc |
5696535 |
T |
|
| Q |
100 |
agacgatgctttattctctgttgactttacgttgataagatgatttactgcttagattttgttctagaccgattagaatctcaatcctatggtgacacgt |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5696536 |
aaacgatgctttattctctgttgactttacgttgataagatgatttgctgcttaaattttgttctagactgattagaatctcaatcctatggtgacacgt |
5696635 |
T |
|
| Q |
200 |
ggatacaaaactattataacgaggcatggtaacctgagtgaacacgctagtctccgtgcacgtaatcacactgaagcacgcccctgtcttcctgcatcgt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
5696636 |
ggatacaaaactattataacgaggcatggtaacctgagtgaacacgctagtctctgtgcacgcaattacactgaagcatgcccctgtcttcctgcatcgt |
5696735 |
T |
|
| Q |
300 |
tcat |
303 |
Q |
| |
|
|||| |
|
|
| T |
5696736 |
tcat |
5696739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University