View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_low_39 (Length: 315)
Name: NF20296_low_39
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_low_39 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 84 - 315
Target Start/End: Original strand, 43337864 - 43338097
Alignment:
| Q |
84 |
ttatgttatttaattgtcatgattatgtatgaatttgttctgatatgtgagtgttttcttaa-tcagatggcaacatggcaatgtgatctcggagaacca |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43337864 |
ttatgttatttaattgtcatgattatgtatgaatttgttctgatatgtgagtgttttcttaaatcagatggcaacatggcaatgtgatctcggagaacca |
43337963 |
T |
|
| Q |
183 |
gtatccatctcaaactaacataactcaaccctttctaaatttatatgtaagcattttcaa-nnnnnnnatataacatgcataaaattatgtatacttatt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43337964 |
gtatccatctcaaactaacataactcaaccctttctaaatttatatgtaagcattttcaattttttttatataacatgcataaaattatgtatacttatt |
43338063 |
T |
|
| Q |
282 |
taccaatgtataatataaaactgtaaatttaaaa |
315 |
Q |
| |
|
|| || |||||||||||||||||||||||||||| |
|
|
| T |
43338064 |
tatcagtgtataatataaaactgtaaatttaaaa |
43338097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 43337805 - 43337845
Alignment:
| Q |
19 |
tacccaaggtaaattcacttcagatccttgacatatatgaa |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43337805 |
tacccaaggtaaattcacttcagatccttgacatatatgaa |
43337845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University