View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_low_51 (Length: 262)
Name: NF20296_low_51
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 69 - 246
Target Start/End: Complemental strand, 47496558 - 47496391
Alignment:
| Q |
69 |
aaaaaatgatattgcataaagtttaaacaaagtttttaaaggaactacttctcatcccctaaacttttgtacataggggaaaagcggtggtgatcaatct |
168 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47496558 |
aaaaattgatattgcataaagtttaaaccaagtttttaaaggaactacttttcatcccctaaacttttgtacatagaggaaaagcggtggtgatcaatct |
47496459 |
T |
 |
| Q |
169 |
tatataagaaatattacataatgaaactatataggcataggatagcatatgtcaggcttacaaaaatatatatttaat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47496458 |
tatataagaaatattacataatgaaactatatagg----------catatgtcaggcttacaaaaatatatatttaat |
47496391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 47497631 - 47497558
Alignment:
| Q |
1 |
aaattaacaatattatttttgagacatctaacaaattaacatactttgcttaaagaaattgtttattgaaaaaa |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47497631 |
aaattaacaatattatttttgagacatctaacaaattaacatactttgcttaaagaaattgtttattgaaaaaa |
47497558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University