View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_low_55 (Length: 250)
Name: NF20296_low_55
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_low_55 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 44085628 - 44085863
Alignment:
| Q |
15 |
ggtgcgaaaagtaatggtctaaaatttatcaattattctatttttgaatcctgcccagtnnnnnnnccacgacaactggacccactaacgaaaccagttc |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44085628 |
ggtgcgaaaagtaatgctctaaaatttatcaattattctatttttgaatcctgcccagtaaaaaaaccacgacaactggacccactaacgaaaccagttc |
44085727 |
T |
 |
| Q |
115 |
tgttctttcttgtcggagaaagaaacacggtgatgtttcacaccaatgatttcagttccacgatcgagaaattttcgtctctgatttcaaactgtgttac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44085728 |
tgttctttcttgtcggagaaagaaacacggtgatgtttcacaccaatgatttcagttccacgatcgagaaattttcgtctctgatttcaaactgtgtttc |
44085827 |
T |
 |
| Q |
215 |
ggcgaaaagtttgaagcatggaaaagcattgcactc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44085828 |
ggcgaaaagtttgaagcatggaaaagcattgcactc |
44085863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University