View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_low_60 (Length: 238)
Name: NF20296_low_60
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44086031 - 44086252
Alignment:
| Q |
1 |
gagttttcaatcaagcttataaactgttcgatgaaatgccgcaaagaaaccttgttagttataactcacttatatcaggtttaacacgtcacgagtttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086031 |
gagttttcaatcaagcttataaactgttcgatgaaatgccgcaaagaaaccttgttagttataactcacttatatcaggtttaacacgtcacgagtttca |
44086130 |
T |
 |
| Q |
101 |
taaagaagctgttaaattttttagggagatgcaaaatggtgttggtgttttgatgttagacgagttcacgcttgttagcatagtgagtaactgttcttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44086131 |
taaagaagctgttaaattttttagggagatgcaaaatggtgttggtggtttgatgttagacgagttcacgcttgttagcctagtgagtaactgttcttgt |
44086230 |
T |
 |
| Q |
201 |
ttgggtactgttaaatggttgc |
222 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
44086231 |
ttggatactgttaaatggttgc |
44086252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University