View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20296_low_66 (Length: 228)
Name: NF20296_low_66
Description: NF20296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20296_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 49706800 - 49706672
Alignment:
| Q |
7 |
tcaatatcaagttattcattaaaatgcaacttctataaattgtaacttctacaaactatagcataccttatagtttgcaacttcttaaatttcttgttaa |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49706800 |
tcaatatcaagtt----attaaaatgcaacttctataaattgtaacttctacagactatagcataccttatagtttgtaacttcttaaatttcttgttaa |
49706705 |
T |
|
| Q |
107 |
ggagtcaaaattcacacgtttgaagtaagcgaa |
139 |
Q |
| |
|
||| |||||||||||| |||||||||||||||| |
|
|
| T |
49706704 |
ggaatcaaaattcacatgtttgaagtaagcgaa |
49706672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 49706674 - 49706625
Alignment:
| Q |
177 |
gaaaatgtgctccactgttttgtggtgatatttgacttagtgcatacctt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
49706674 |
gaaaatgtgctccactgttttgtggtgatatttgacttactgcgtacctt |
49706625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University