View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_high_20 (Length: 292)
Name: NF20298_high_20
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 278
Target Start/End: Complemental strand, 32822566 - 32822299
Alignment:
| Q |
11 |
cacagagaaaaccataaccaagttcgaagagtacagagactcaatcaaagcaaaagcaacaaatctctcnnnnnnncatccccgctgcatagcagacgga |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32822566 |
cacacagaaaaccataaccaagttcgaagagtacagagactcaatcaaagcaaaagcaacaaatctctcaaaaaaacatccccgctgcatagcagacgga |
32822467 |
T |
|
| Q |
111 |
aacgagttactaaggtttcactgcacaagctttgtttgttctttaggcctaaacggttcctcaaatctctgcaactcaacatcacaatgcaatgtatgcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32822466 |
aacgagttactaaggtttcactgcacaacctttgtttgttctttaggcctaaacggttcctcaaatctctgcaactcaacatcacaatgcaatgtgtgcg |
32822367 |
T |
|
| Q |
211 |
gcataataaaacacgggtttaagttgaatggtggcgatgggatattgacgacagcaacgagtgggaaa |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822366 |
gcataataaaacacgggtttaagttgaatggtggcgatgggatattgacgacagcaacgagtgggaaa |
32822299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University