View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_high_28 (Length: 241)
Name: NF20298_high_28
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 33495218 - 33495035
Alignment:
| Q |
20 |
tgttttgctttatgacccttttatcagaattttacgtgattactatatataatt-cgttactaacatgaatgtctatccgcttttttgtatcaaaattaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495218 |
tgttttgctttatgacccttttatcagaattttacgtgattactatatataatttcgttactaacatgaatgtctatccgcttttttgtatcaaaattaa |
33495119 |
T |
|
| Q |
119 |
taatacaagtttcaaaattttatcttagattgttnnnnnnnnntcaattatttgattggaaatgaatgaaaaatagttgcacacaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495118 |
taatacaagtttcaaaattttatctttgattgtt--aaaaaaatcaattatttgattggaaatgaatgaaaaatagttgcacacaa |
33495035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University