View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_high_29 (Length: 233)
Name: NF20298_high_29
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 44628358 - 44628573
Alignment:
| Q |
1 |
taatgctgataaatagtcactttctagttaaagctagggagacataatcccctatagaatttaacttgaccttttttgtcttcaaatttcattctgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44628358 |
taatgctgataaatagtcactttctagttaaagctagggagacataatcccctatagaatttaacttgaccttttttgtcttcaaatttcattctgattt |
44628457 |
T |
 |
| Q |
101 |
tctgctcctgttcaatgatatcatttcaattcattggttctgttcttcatatgcatttatttatcaagtgtcattgttggctctggatggaagataacgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44628458 |
tctgctcctgttcaatgatatcatttcaattcattggttttgttcttcatatgcatttatttatcaagtgtcattgttggctctggatggaagataacag |
44628557 |
T |
 |
| Q |
201 |
ttaagaatgcaagtaag |
217 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
44628558 |
ttaa-aatgcaagtaag |
44628573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 160
Target Start/End: Original strand, 26081651 - 26081715
Alignment:
| Q |
97 |
attttctgctcctgttcaatgatatcatttcaattcattggttctgttcttcat-atgcatttat |
160 |
Q |
| |
|
||||||||| | |||||||||||||| ||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
26081651 |
attttctgcactagttcaatgatatcacttcaagtcattggttttgttcttcctcatgcatttat |
26081715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University