View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_high_33 (Length: 205)
Name: NF20298_high_33
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 33507940 - 33507880
Alignment:
| Q |
15 |
gaagaagaatgccacgcagaggaagcggttcgcaacggaagaagagaccctcgggtagtta |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33507940 |
gaagaagaatgccacgcagaggaagcggttcgcaacggaagaagagaccatcgggtagtta |
33507880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 108 - 189
Target Start/End: Complemental strand, 33507848 - 33507770
Alignment:
| Q |
108 |
ttattggttttccccgaaatgaaacttcattcattagaacacaagaaggtaaagaatgtccggaaatgtgggagttagtttt |
189 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33507848 |
ttattggttttcccctaaatggaacttcattcattagaacac---aaggtaaggaatgtccggaaatgtgggagttagtttt |
33507770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University