View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_low_16 (Length: 337)
Name: NF20298_low_16
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 322
Target Start/End: Complemental strand, 49747005 - 49746706
Alignment:
| Q |
14 |
ttatactacaaggattaccatgtgtcctaaaggggttaaatatgaactaataatctaatatactacagtttacagaggacacacctttcnnnnnnnnnag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49747005 |
ttatactacaaggattaccatgtgtcctaaaggggttaaatatgaactaataatctaatatactacagtttacagaggacacaccttt---tttttttag |
49746909 |
T |
 |
| Q |
114 |
gaaacataggacacaacttaaatacagttgcttaggtcttgttaatctatattctaaattaagcgcacccactctcttatccttattaataaagccaacc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49746908 |
gaaacataggacacaacttaaatacagttgcttaggtcttgttaatctatattgtaaattaagggcacccactctcttatccttattaataaagccaacc |
49746809 |
T |
 |
| Q |
214 |
acaaccactaagagtacgtctatggtgcaaccaacattgatatcttaaccgattaaacaattgtttctctttttggatcatgttaacaaatgtctaagaa |
313 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49746808 |
ac------taagagtacgtctatggtgcaaccaacattgatatcttaaccaattaaacaattgtttctctttttggatcatgttaacaaatgtctaagaa |
49746715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University