View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_low_19 (Length: 328)
Name: NF20298_low_19
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 43 - 319
Target Start/End: Complemental strand, 37653644 - 37653368
Alignment:
| Q |
43 |
aagctttggtgaagagtgctccttggccaaatgtggaagaatgatcggctgcgttgacaccgatggtgatggcagaattgatttctatgaatttagaatc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37653644 |
aagctttggtgaagagtgctccttggccaaatgtggaagaatgataggctgcgttgacaccgatggtgatggcagaattgatttcgatgaatttagaatc |
37653545 |
T |
|
| Q |
143 |
atgatgatggacatgtagttcttccctctgccactggatcaaagtcattcttcaaattgttattatcgccacatatatccaatgatttatttattatgta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37653544 |
atgatgatggacatgtagttcttccctctgccactggatcgaagtcattcttcaaattgttattatcgccacatatatccaatgatttatttattatgta |
37653445 |
T |
|
| Q |
243 |
tgggtgaagtagtcgaagtttcctagcaatatagatggttacctttaacatctttacctaggtttgtggatattctt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37653444 |
tgggtgaagtagtcgaagtttcctagcaatatagatggttacctttaacatctttacctaggtttgtggattttctt |
37653368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 151
Target Start/End: Complemental strand, 37655501 - 37655371
Alignment:
| Q |
21 |
aggagctcaatacggttatgaaaagctttggtgaagagtgctccttggccaaatgtggaagaatgatcggctgcgttgacaccgatggtgatggcagaat |
120 |
Q |
| |
|
||||||| || ||| |||||| |||| ||||| ||||||| ||||||| |||||| |||||| || || ||||||| | ||||||||||| || || |
|
|
| T |
37655501 |
aggagcttaacacgcttatgagaagcattggtcaagagtgttccttggatgaatgtgaaagaattattggtcgcgttgatagtgatggtgatggtaggat |
37655402 |
T |
|
| Q |
121 |
tgatttctatgaatttagaatcatgatgatg |
151 |
Q |
| |
|
|||||| | || |||||||||||||||||| |
|
|
| T |
37655401 |
tgattttgaggattttagaatcatgatgatg |
37655371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University