View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_low_20 (Length: 321)
Name: NF20298_low_20
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 44 - 292
Target Start/End: Original strand, 38014849 - 38015108
Alignment:
| Q |
44 |
atgcatagggtatgcacttttaagagaatgggatcaggatggacaatat------------ggtgctataaaactagatccatggaaggttcatgaaagg |
131 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38014849 |
atgcatagggtatccacttttaagagaatgggatcaggatggacagtaataaggacaattaggtgctataaaactagttccatggaaggttcatgaaagg |
38014948 |
T |
|
| Q |
132 |
tcagataatagtcgttaacaaattcttataacatatatggtaagatgcacaattgcataaacaccttgcagtataaacaaatatccacttagaccaaagt |
231 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||| ||||| | |||||| ||||||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
38014949 |
tcagacaatagccgttaataaattcttataacatttatggga-gatgcagaattgcataaacaccttacagtataaacaaatatccacgtggaccaaagt |
38015047 |
T |
|
| Q |
232 |
gtcatttctctctctcaaattaaagccaaggcttattggtgggtgatatgattgatagaaa |
292 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38015048 |
gtcatttttctctctcaaattaaagccaaggcttattggtgggtgatatgattgatagaaa |
38015108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 38014724 - 38014777
Alignment:
| Q |
19 |
aaatgaacactgaaccaaagtgtccatgcatagggtatgcacttttaagagaat |
72 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
38014724 |
aaatgaacactgaaccaaagtgtctaaccatagggtatgcacttttaagagaat |
38014777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University