View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_low_25 (Length: 257)
Name: NF20298_low_25
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 52809448 - 52809239
Alignment:
| Q |
20 |
tggattccagagaacctaaacaaagggcacatggataggtttttctttcttctagcagggctagttgtttttgattttgtgatttacttgttctgtgcta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809448 |
tggattccagagaacctaaacaaagggcacatggataggtttttctttcttctagcagggctagttgtttttgattttgtgatttacttgttctgtgcta |
52809349 |
T |
 |
| Q |
120 |
agtggtacaagagtatcaatgttcaaggtgaccaagaggagttggatgatgatgttgctcaag---ttataattaagtcggcatccaaagaccaaccttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52809348 |
agtggtacaagagtatcaatgttcaaggtgaccaagaggagttggatgatgatgatgctcaagttattataattaagtcggcatccaaagaccaaccttt |
52809249 |
T |
 |
| Q |
217 |
aacaccacaa |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
52809248 |
aacaccacaa |
52809239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University