View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_low_34 (Length: 231)
Name: NF20298_low_34
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 4500022 - 4500210
Alignment:
| Q |
18 |
gtttgaaccgcaaatagacatttgtggtgtcatgcaaaacgagcctaaggcctattgaacagccgatgataaaaataattccgatacaatttgaaagcga |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4500022 |
gtttgaaccgcaaatagacgtttgtggtgtcatgcaaaacgagcctaaggccgattgaacagccgatgataaaaataattccgatacaatttgaaagcaa |
4500121 |
T |
 |
| Q |
118 |
ggaacacactcatattggccttaggcatatatgagtgtcactcgctttcatattgtaaaatggctaaagcaatgtgggacacttgagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4500122 |
ggaacacactcatattggccttagacgtatatgagtgtcactcgctttcatattgtaaaatgactaaagcaatgtgggacacttgagaa |
4500210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University