View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20298_low_34 (Length: 231)

Name: NF20298_low_34
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20298_low_34
NF20298_low_34
[»] chr7 (1 HSPs)
chr7 (18-206)||(4500022-4500210)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 4500022 - 4500210
Alignment:
18 gtttgaaccgcaaatagacatttgtggtgtcatgcaaaacgagcctaaggcctattgaacagccgatgataaaaataattccgatacaatttgaaagcga 117  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |    
4500022 gtttgaaccgcaaatagacgtttgtggtgtcatgcaaaacgagcctaaggccgattgaacagccgatgataaaaataattccgatacaatttgaaagcaa 4500121  T
118 ggaacacactcatattggccttaggcatatatgagtgtcactcgctttcatattgtaaaatggctaaagcaatgtgggacacttgagaa 206  Q
    |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
4500122 ggaacacactcatattggccttagacgtatatgagtgtcactcgctttcatattgtaaaatgactaaagcaatgtgggacacttgagaa 4500210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University