View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20298_low_35 (Length: 212)
Name: NF20298_low_35
Description: NF20298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20298_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 20 - 167
Target Start/End: Original strand, 350200 - 350344
Alignment:
| Q |
20 |
caccatttagtttctctgctcctattttcttgttctcaacatcaacctctaaacttaacatcttcgatcgccaactcaaacgcaatcaggtaggtatacc |
119 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
350200 |
caccattttgtttctctgctcctcttttcttcttcacaacatcaacctctaaacttaacatcttcgatcgccaactcaaacgcaatcaggtaggtatacc |
350299 |
T |
|
| Q |
120 |
tttatctctataatttcattcattgctttgttgattgatgatgtgatt |
167 |
Q |
| |
|
||| ||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
350300 |
tttctctctctaatttcattcattgc---gttgattgatgatgtgatt |
350344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University