View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20299_high_12 (Length: 254)

Name: NF20299_high_12
Description: NF20299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20299_high_12
NF20299_high_12
[»] chr5 (1 HSPs)
chr5 (15-66)||(33363224-33363275)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 66
Target Start/End: Original strand, 33363224 - 33363275
Alignment:
15 caaaggtcacatgataaatctgtattgcactaagttgctgctggttcgaaat 66  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||    
33363224 caaaggtcacatgataaatctgcattgcactaagttgctgctggttcgaaat 33363275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University