View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20299_low_15 (Length: 237)
Name: NF20299_low_15
Description: NF20299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20299_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 46103691 - 46103893
Alignment:
| Q |
17 |
attggataaggcaacccttgnnnnnnntatcgctggcagttctttcccaccataacaaacatactatgcgagccagaaattgaaatgaaaacattaaaa- |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
46103691 |
attggataaggcaacccttgaaaaaaatatcgctggcagttctttcccaccataacatacatact-tgcaagcgagaaattgaaatgaaaacattaaaaa |
46103789 |
T |
|
| Q |
116 |
ttgcatgaatgaatttggtggtaatagtaatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46103790 |
ttgcatgaatgaatttggtggtaatagtaatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttc |
46103889 |
T |
|
| Q |
216 |
aaac |
219 |
Q |
| |
|
|||| |
|
|
| T |
46103890 |
aaac |
46103893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University