View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20299_low_16 (Length: 237)
Name: NF20299_low_16
Description: NF20299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20299_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 6220930 - 6221145
Alignment:
| Q |
1 |
tccatgcatctttaatatgattctggttgtgagaaggtaacataacattcacacaaagattaatgcacaccaattatgttcaagtggttaatgagtttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6220930 |
tccatgcatctttaatatgattctggttgtgagaaggtaacataacattcacacaaagattaatgcacaccaattacgttcaagtgattaatgagtttta |
6221029 |
T |
 |
| Q |
101 |
cttaaaaataaattgttcggaagaactcaagttcgtttcttggatnnnnnnnctttttatcagactttatttacctcacgtttaccgctgcattactgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||| ||| |||||| |||||||| |
|
|
| T |
6221030 |
cttaaaaataaattgttcggaagaactcgagttcgtttcttggataaaataactttttatcagactttattta-ctcacgcttagcgctgctttactgga |
6221128 |
T |
 |
| Q |
201 |
atctttttcccctaaat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6221129 |
atctttttcccctaaat |
6221145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University