View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20299_low_18 (Length: 230)
Name: NF20299_low_18
Description: NF20299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20299_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 32 - 213
Target Start/End: Complemental strand, 45126901 - 45126720
Alignment:
| Q |
32 |
cctcaaccatttgattggtgatgccccaatatatgaaaaaacctatggtgtgcgcagcaaaaagaaccatagataattgtccaagccagatatgatattt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45126901 |
cctcaaccatttgattggtgatgccccaatatatgaaaaaacctatggtgtgcgcagcaaaaagaaccatagataattgtccaagccagatatgatattt |
45126802 |
T |
|
| Q |
132 |
gatgcttgactcagatgtgagaccaacaagacgcagaatggaagaccctcttgtaactggaaagaacaaaaatgcccaacat |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45126801 |
gatgcttgactcagatgtgagtccaacaagacgcagaatggaagaccctcttgtaaccggaaagaacaaaaatgcccaacat |
45126720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 32 - 213
Target Start/End: Complemental strand, 45109705 - 45109524
Alignment:
| Q |
32 |
cctcaaccatttgattggtgatgccccaatatatgaaaaaacctatggtgtgcgcagcaaaaagaaccatagataattgtccaagccagatatgatattt |
131 |
Q |
| |
|
|||||| |||||| || |||||| ||||||| |||| |||||| |||| || |||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45109705 |
cctcaatcatttggttagtgatggcccaataaatgataaaaccaatggaatgagcagcaaagagaaccatagataattgtccaagccagatatgatactt |
45109606 |
T |
|
| Q |
132 |
gatgcttgactcagatgtgagaccaacaagacgcagaatggaagaccctcttgtaactggaaagaacaaaaatgcccaacat |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| |||||| |||||| ||||||||||||||||||||| ||||| |
|
|
| T |
45109605 |
gatgcttgactcagatgtgagtccaacaagaggcagaatagaagacattcttgtgactggaaagaacaaaaatgccaaacat |
45109524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University