View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20299_low_19 (Length: 216)
Name: NF20299_low_19
Description: NF20299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20299_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 21930342 - 21930512
Alignment:
| Q |
14 |
cagagagaaagaaacagtaaagtaatgtaaaggatgagacaaaaaggaaagagagattacaagggttagggtattgtggtgaattagataggtnnnnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21930342 |
cagagagaaagaaacagtaaagtaatgtaaaggatgagacaaaaaggaaagagagattacaagggttagggtattgtggtgaattagataggtaaaaaaa |
21930441 |
T |
 |
| Q |
114 |
gtactatgtctcttatgttgatgttccttttagaggagcattcaagtagggtttaacagtacttcatgcac |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21930442 |
gtactatgtctcttatgttgatgttccttttagaggagcattcaagtagggtttaacagtacttcatgcac |
21930512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 160
Target Start/End: Complemental strand, 43168945 - 43168917
Alignment:
| Q |
132 |
tgatgttccttttagaggagcattcaagt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43168945 |
tgatgttccttttagaggagcattcaagt |
43168917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University