View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20299_low_6 (Length: 366)
Name: NF20299_low_6
Description: NF20299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20299_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 7 - 218
Target Start/End: Complemental strand, 52888403 - 52888192
Alignment:
| Q |
7 |
tgttgaagaaggtgcagaagatgtttgtgatgttcgactccatgaacatggtggtgatgatttaactatatctaaatccaaaccgatggttcttcctcct |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888403 |
tgttgaagaaggtgaagaagatgtttgtgatgttcgactccatgaacatggtggtgatgatttaactatatctaaatccaaaccgatggttcttcctcct |
52888304 |
T |
|
| Q |
107 |
gttccactaaaacacgaagacatttttggcaagtggttgcgagtaataaacagtgacaacggagaagtgaaattcaaaaaggaattaagaattgcatatt |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888303 |
gttccactaaaacaagaagacatttttggcaagtggttgcaagtaataaacagtgacaaaggagaagtgaaattcaaaaaggaattaagaattgcatatt |
52888204 |
T |
|
| Q |
207 |
gaggatgggaag |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52888203 |
gaggatgggaag |
52888192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 311 - 365
Target Start/End: Complemental strand, 52888098 - 52888044
Alignment:
| Q |
311 |
ggggtttagtttagaatatagagaaagaacaaagaacctgaaattgattggtttt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888098 |
ggggtttagtttagaatatagagaaagaacaaagaacctgaaattgattggtttt |
52888044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University