View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2029_low_10 (Length: 238)
Name: NF2029_low_10
Description: NF2029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2029_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 60 - 238
Target Start/End: Complemental strand, 1247940 - 1247763
Alignment:
| Q |
60 |
actcctttataatattaagattcaaagtatttttgtctcggccaaaataaaaagaatgnnnnnnngtctccataatagaattgcactttttagtcttttc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1247940 |
actcctttataatattaagattcaaagtatttttgtctcggccaaaataaaaaggatgtttttttgtcttcataatagaattgcactttttagtcctttc |
1247841 |
T |
 |
| Q |
160 |
aaagatatcttgcaaataaatttagtcatttgttgttaagttnnnnnnntaattttgaatgctttattctagacatgat |
238 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
1247840 |
aaagatatcttgcaaataattttaatcatttgtggttaagtt-aaaaaatatttttgaatgctttattctagacatgat |
1247763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University