View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2029_low_9 (Length: 238)
Name: NF2029_low_9
Description: NF2029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2029_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 34 - 223
Target Start/End: Original strand, 45944453 - 45944643
Alignment:
| Q |
34 |
attagagtcactttatatcatcatcaaattgattttatcagtatagaagttgatttcttcaaccttttaatcaaagaatttgagaatagaaaatgagagg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45944453 |
attagagtcactttatatcatcatcaaattgatcttatcagtatagaagttgatttcttcaaccttttagtcaaagaatttgagaatagaaaatgagagg |
45944552 |
T |
|
| Q |
134 |
agcaa-annnnnnnnnnnnnnattattaggtagttatgtagcgtctctttgaatctcttttgatgttatgagtcattttatgtgatcttta |
223 |
Q |
| |
|
| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45944553 |
aacaatttttttttattttttattataaggtagttatgtagcgtctctttgaatctcttttgatgttatgagtcattttatgtgatcttta |
45944643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University