View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_high_45 (Length: 226)
Name: NF20300_high_45
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 11298557 - 11298766
Alignment:
| Q |
1 |
tcaatggtgaacctaatggaccatccggaggtgcagtagcagcatgagtcaatgtgataacagtattcctccatatcaatggcccaaatacatcacaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
11298557 |
tcaatggtgaacctaatggaccatccggaggtgcagtggcagcatgagtcaatgtgataacagtattcctccatatcaatggaccaaatacattacaaat |
11298656 |
T |
 |
| Q |
101 |
tgttctcaacaatggtaaatcgttgagattcttagtttgtatgtcgagacggtcgacatagagaacaatgtcaattggttttttctttgttaactttgga |
200 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| || |
|
|
| T |
11298657 |
tgttctcaacagtggtaaatcattgagattcttagtttgtatgtcgagacggtcgacatagagaacaatatcaagtggttttttctttgttaacttttga |
11298756 |
T |
 |
| Q |
201 |
atcatagata |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
11298757 |
atcatagata |
11298766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University