View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_high_49 (Length: 220)
Name: NF20300_high_49
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 27 - 199
Target Start/End: Complemental strand, 44005153 - 44004981
Alignment:
| Q |
27 |
tcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatctctcaaacaaatgcttatggatgcaaaggccatttggtt |
126 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44005153 |
tcataggtggaaaatttgtaggatcctcaaaagatgtgatatctcatcatgttgatggatcactcaaacaaatgcttatggatgcaaaggccatttggtt |
44005054 |
T |
 |
| Q |
127 |
ttagttatagtttcattcagaactctttataactttataccaaaagtggtacgaaggaaggagttctggtaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44005053 |
ttagttatagtttcattcagaactctttatagctttataccaaaagtggtacgaaggaaggagttctggtaat |
44004981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 27 - 157
Target Start/End: Complemental strand, 44009079 - 44008949
Alignment:
| Q |
27 |
tcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatctctcaaacaaatgcttatggatgcaaaggccatttggtt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44009079 |
tcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatctctcaaacaaatgcttatggatgcaaaggccatttggtt |
44008980 |
T |
 |
| Q |
127 |
ttagttatagtttcattcagaactctttata |
157 |
Q |
| |
|
||||| ||| || |||||||||||||||||| |
|
|
| T |
44008979 |
ttagtcatatttccattcagaactctttata |
44008949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 131
Target Start/End: Original strand, 39846834 - 39846938
Alignment:
| Q |
27 |
tcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatctctcaaacaaatgcttatggatgcaaaggccatttggtt |
126 |
Q |
| |
|
|||| |||||||||||||| || || ||||| ||||||||||||| ||||||||||||||| |||||||||||||| |||| ||| | ||||||||||| |
|
|
| T |
39846834 |
tcattggtggaaaatttgtagggtcatcaaaggatgtgatatctcttcatgttgatggatcactcaaacaaatgctcatggctgctagagccatttggtt |
39846933 |
T |
 |
| Q |
127 |
ttagt |
131 |
Q |
| |
|
|||| |
|
|
| T |
39846934 |
ctagt |
39846938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University