View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_low_32 (Length: 307)
Name: NF20300_low_32
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 291
Target Start/End: Original strand, 38302212 - 38302490
Alignment:
| Q |
13 |
attttatggtttaaatttttgtttcaatgttaattgcattctttttaattacttatgaacaatgtcctgttcgggttaactctgagttttagctgaacta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38302212 |
attttatggtttaaatttttgtttcaatgttaattgcattctttttaattacttatgaacaatgtcctgttcgggttagctctgagttttagctgaacta |
38302311 |
T |
 |
| Q |
113 |
tgagnnnnnnn-gctgatgtatttgagttttggccctctttgatctnnnnnnnntgaaaacatcgactttaatcgaaactttgttacacgctattcacac |
211 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38302312 |
tgagtttttttagatgatgtatttgagttttggccctctttgatctaaaaaaa-tgaaaacatcgactttaatcgaaactttgttacacgctattcacac |
38302410 |
T |
 |
| Q |
212 |
atcaattatccaaactttggtaaattgatcgcttggtcctaccatacttaaaaaataaggataaatatgtttttggtcct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38302411 |
atcaattatccaaactttggtaaattgatcgcttggtcctaccatacttaaaaaataaggataaatatatttttggtcct |
38302490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University