View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_low_36 (Length: 304)
Name: NF20300_low_36
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_low_36 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 14 - 135
Target Start/End: Complemental strand, 19658210 - 19658078
Alignment:
| Q |
14 |
catagggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtt-----------tttgctgtttctttgggaggtgtg |
102 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19658210 |
catagggcgttttgtgagtgtaattttaaggagcaattttcttgttgtatgatgttaacggggtttttgggcggtttttgctgtttctttgggaggtgtg |
19658111 |
T |
 |
| Q |
103 |
tttttggatgaaggtgcttgggagtgctaatga |
135 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||| |
|
|
| T |
19658110 |
tgtttggatgaaggtgcttgggagtgcaaatga |
19658078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 19657988 - 19657922
Alignment:
| Q |
224 |
agcagcggaatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19657988 |
agcagcggaatgtaattgtggaagttgtttttgtggcagcttgtgatgatgtttgaggaatttggta |
19657922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 87 - 134
Target Start/End: Complemental strand, 6409794 - 6409747
Alignment:
| Q |
87 |
ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
6409794 |
ttctttgggaggtgtgtttttggatgaaggtgctcgggagagctaatg |
6409747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 289
Target Start/End: Complemental strand, 6409657 - 6409592
Alignment:
| Q |
224 |
agcagcggaatgtaattg-tggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggt |
289 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
6409657 |
agcagcggaatgtaggtggtggaagttgtttttgtggcag-ttgtgatgatgtttgaggattttggt |
6409592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 118
Target Start/End: Complemental strand, 54199661 - 54199633
Alignment:
| Q |
90 |
tttgggaggtgtgtttttggatgaaggtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54199661 |
tttgggaggtgtgtttttggatgaaggtg |
54199633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 27741428 - 27741487
Alignment:
| Q |
19 |
ggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27741428 |
ggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttacctgggtt |
27741487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 14993614 - 14993548
Alignment:
| Q |
224 |
agcagcggaatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta |
290 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
14993614 |
agcagcggaatgtaatggtggaagttgtttttgtgacggcttgtgatgatgtttgagggatttggta |
14993548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 286
Target Start/End: Original strand, 27741622 - 27741684
Alignment:
| Q |
224 |
agcagcggaatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaattt |
286 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27741622 |
agcaacggaatgtaatggtggatgttgtttttgtggcaacttgtgatgatgtttgagggattt |
27741684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 134
Target Start/End: Complemental strand, 43275718 - 43275672
Alignment:
| Q |
87 |
ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg |
134 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
43275718 |
ttctttgtgaggtgtgtttt-ggatgaaggtgcttgggagagctaatg |
43275672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 135
Target Start/End: Original strand, 27741510 - 27741554
Alignment:
| Q |
91 |
ttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatga |
135 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
27741510 |
ttgggaggtgtgtttttggatgaagatgtttgggagaactaatga |
27741554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 134
Target Start/End: Complemental strand, 22577635 - 22577505
Alignment:
| Q |
14 |
catagggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtttttg--ctgt--------ttctttgggaggtgtgt |
103 |
Q |
| |
|
||||||||||||||||||| | |||| ||||| |||||||||||||| |||||||||||||||||||| | || ||||||||||||||| | |
|
|
| T |
22577635 |
catagggcgttttgtgagttcattttttaggaggaattttcttgttgtttgatgttaccggggtttttggtcggtttttgctgttctttgggaggtgtat |
22577536 |
T |
 |
| Q |
104 |
ttttggatgaaggtgcttgggagtgctaatg |
134 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |
|
|
| T |
22577535 |
ttttggatgaaggtgtttgggagagctaatg |
22577505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 232 - 290
Target Start/End: Complemental strand, 22577472 - 22577414
Alignment:
| Q |
232 |
aatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta |
290 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
22577472 |
aatgtaatggtcgaagttgtttttgtggctgcttgtgatgatgtttgagggatttggta |
22577414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 87 - 134
Target Start/End: Complemental strand, 54241 - 54194
Alignment:
| Q |
87 |
ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg |
134 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54241 |
ttctttggaaagtgtgtttttggatgaaggtgcttgggagagctaatg |
54194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 54440 - 54379
Alignment:
| Q |
22 |
gttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtttttgc |
83 |
Q |
| |
|
|||||||| |||||| |||| |||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
54440 |
gttttgtggctgtaatattgaagagcaattttcttgttgtataatgttataggcgtttttgc |
54379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 134
Target Start/End: Original strand, 7767372 - 7767418
Alignment:
| Q |
87 |
ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg |
134 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
7767372 |
ttctttgtgaggtgtgtttt-ggatgaaggtgcttgggagagctaatg |
7767418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 290
Target Start/End: Complemental strand, 5994234 - 5994186
Alignment:
| Q |
241 |
gtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta |
290 |
Q |
| |
|
|||||||||||||||||||| | |||||| |||||||||||| ||||||| |
|
|
| T |
5994234 |
gtggaagttgtttttgtggtag-ttgtgacgatgtttgaggattttggta |
5994186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 290
Target Start/End: Complemental strand, 6443641 - 6443593
Alignment:
| Q |
241 |
gtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta |
290 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
6443641 |
gtggaagttgtttttgtggcag-ttgtgatgatgtttgaggattttggta |
6443593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University