View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20300_low_36 (Length: 304)

Name: NF20300_low_36
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20300_low_36
NF20300_low_36
[»] chr4 (5 HSPs)
chr4 (14-135)||(19658078-19658210)
chr4 (224-290)||(19657922-19657988)
chr4 (87-134)||(6409747-6409794)
chr4 (224-289)||(6409592-6409657)
chr4 (90-118)||(54199633-54199661)
[»] chr3 (5 HSPs)
chr3 (19-78)||(27741428-27741487)
chr3 (224-290)||(14993548-14993614)
chr3 (224-286)||(27741622-27741684)
chr3 (87-134)||(43275672-43275718)
chr3 (91-135)||(27741510-27741554)
[»] chr6 (2 HSPs)
chr6 (14-134)||(22577505-22577635)
chr6 (232-290)||(22577414-22577472)
[»] scaffold0009 (2 HSPs)
scaffold0009 (87-134)||(54194-54241)
scaffold0009 (22-83)||(54379-54440)
[»] chr5 (1 HSPs)
chr5 (87-134)||(7767372-7767418)
[»] chr8 (2 HSPs)
chr8 (241-290)||(5994186-5994234)
chr8 (241-290)||(6443593-6443641)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 14 - 135
Target Start/End: Complemental strand, 19658210 - 19658078
Alignment:
14 catagggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtt-----------tttgctgtttctttgggaggtgtg 102  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||           ||||||||||||||||||||||||    
19658210 catagggcgttttgtgagtgtaattttaaggagcaattttcttgttgtatgatgttaacggggtttttgggcggtttttgctgtttctttgggaggtgtg 19658111  T
103 tttttggatgaaggtgcttgggagtgctaatga 135  Q
    | ||||||||||||||||||||||||| |||||    
19658110 tgtttggatgaaggtgcttgggagtgcaaatga 19658078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 19657988 - 19657922
Alignment:
224 agcagcggaatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta 290  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
19657988 agcagcggaatgtaattgtggaagttgtttttgtggcagcttgtgatgatgtttgaggaatttggta 19657922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 87 - 134
Target Start/End: Complemental strand, 6409794 - 6409747
Alignment:
87 ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg 134  Q
    |||||||||||||||||||||||||||||||||| ||||| |||||||    
6409794 ttctttgggaggtgtgtttttggatgaaggtgctcgggagagctaatg 6409747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 289
Target Start/End: Complemental strand, 6409657 - 6409592
Alignment:
224 agcagcggaatgtaattg-tggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggt 289  Q
    ||||||||||||||  || ||||||||||||||||||  | ||||||||||||||||||| ||||||    
6409657 agcagcggaatgtaggtggtggaagttgtttttgtggcag-ttgtgatgatgtttgaggattttggt 6409592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 118
Target Start/End: Complemental strand, 54199661 - 54199633
Alignment:
90 tttgggaggtgtgtttttggatgaaggtg 118  Q
    |||||||||||||||||||||||||||||    
54199661 tttgggaggtgtgtttttggatgaaggtg 54199633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 27741428 - 27741487
Alignment:
19 ggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtt 78  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
27741428 ggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttacctgggtt 27741487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 14993614 - 14993548
Alignment:
224 agcagcggaatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta 290  Q
    |||||||||||||||| ||||||||||||||||||   |||||||||||||||||||| ||||||||    
14993614 agcagcggaatgtaatggtggaagttgtttttgtgacggcttgtgatgatgtttgagggatttggta 14993548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 286
Target Start/End: Original strand, 27741622 - 27741684
Alignment:
224 agcagcggaatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaattt 286  Q
    |||| ||||||||||| ||||| |||||||||||||   ||||||||||||||||||| ||||    
27741622 agcaacggaatgtaatggtggatgttgtttttgtggcaacttgtgatgatgtttgagggattt 27741684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 134
Target Start/End: Complemental strand, 43275718 - 43275672
Alignment:
87 ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg 134  Q
    ||||||| |||||||||||| ||||||||||||||||||| |||||||    
43275718 ttctttgtgaggtgtgtttt-ggatgaaggtgcttgggagagctaatg 43275672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 135
Target Start/End: Original strand, 27741510 - 27741554
Alignment:
91 ttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatga 135  Q
    ||||||||||||||||||||||||| || |||||||  |||||||    
27741510 ttgggaggtgtgtttttggatgaagatgtttgggagaactaatga 27741554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 134
Target Start/End: Complemental strand, 22577635 - 22577505
Alignment:
14 catagggcgttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtttttg--ctgt--------ttctttgggaggtgtgt 103  Q
    |||||||||||||||||||  | |||| ||||| |||||||||||||| ||||||||||||||||||||  | ||        ||||||||||||||| |    
22577635 catagggcgttttgtgagttcattttttaggaggaattttcttgttgtttgatgttaccggggtttttggtcggtttttgctgttctttgggaggtgtat 22577536  T
104 ttttggatgaaggtgcttgggagtgctaatg 134  Q
    ||||||||||||||| ||||||| |||||||    
22577535 ttttggatgaaggtgtttgggagagctaatg 22577505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 232 - 290
Target Start/End: Complemental strand, 22577472 - 22577414
Alignment:
232 aatgtaattgtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta 290  Q
    |||||||| || |||||||||||||||| ||||||||||||||||||||| ||||||||    
22577472 aatgtaatggtcgaagttgtttttgtggctgcttgtgatgatgtttgagggatttggta 22577414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 87 - 134
Target Start/End: Complemental strand, 54241 - 54194
Alignment:
87 ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg 134  Q
    |||||||| | ||||||||||||||||||||||||||||| |||||||    
54241 ttctttggaaagtgtgtttttggatgaaggtgcttgggagagctaatg 54194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 54440 - 54379
Alignment:
22 gttttgtgagtgtaattttgaggagcaattttcttgttgtatgatgttaccggggtttttgc 83  Q
    ||||||||  |||||| |||| |||||||||||||||||||| ||||||  || ||||||||    
54440 gttttgtggctgtaatattgaagagcaattttcttgttgtataatgttataggcgtttttgc 54379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 87 - 134
Target Start/End: Original strand, 7767372 - 7767418
Alignment:
87 ttctttgggaggtgtgtttttggatgaaggtgcttgggagtgctaatg 134  Q
    ||||||| |||||||||||| ||||||||||||||||||| |||||||    
7767372 ttctttgtgaggtgtgtttt-ggatgaaggtgcttgggagagctaatg 7767418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 290
Target Start/End: Complemental strand, 5994234 - 5994186
Alignment:
241 gtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta 290  Q
    |||||||||||||||||||| | |||||| |||||||||||| |||||||    
5994234 gtggaagttgtttttgtggtag-ttgtgacgatgtttgaggattttggta 5994186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 290
Target Start/End: Complemental strand, 6443641 - 6443593
Alignment:
241 gtggaagttgtttttgtggttgcttgtgatgatgtttgaggaatttggta 290  Q
    |||||||||||||||||||  | ||||||||||||||||||| |||||||    
6443641 gtggaagttgtttttgtggcag-ttgtgatgatgtttgaggattttggta 6443593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University