View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_low_39 (Length: 292)
Name: NF20300_low_39
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 40803374 - 40803111
Alignment:
| Q |
19 |
atcttttacctatggaaacttgaaattgatgaatggtgtaaagggggaacatgacatggaaaatacggggaaaatgttgacattaatgcttttttgtgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40803374 |
atcttttacctatggaaacttgaaattgatgaatggtgtaaagggggaacatgacatggaaaatacggggaaaatgttgacattaatgcttttttgtgct |
40803275 |
T |
|
| Q |
119 |
tgctgcaagttttctaaccggtgacttcttcaacttttgatgcagtgacttcaaacagcgattgtctgaacaccatgatgaagtgcatagcggtaagatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40803274 |
tgctgcaagttttctaaccggtgacttcttcaacttttgatgcagtgacttcaaacagcgattgtctgaacaccatgatgaagtgcatagcggtaagatt |
40803175 |
T |
|
| Q |
219 |
ttggttatattctttgagctaaatccaatttccgtatatcgttatttcatgctttggattcttc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40803174 |
ttggttatattctttgagctaaatccaatttccgtatatcgttatttcatgctttggattcttc |
40803111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 226
Target Start/End: Original strand, 4642492 - 4642531
Alignment:
| Q |
187 |
aacaccatgatgaagtgcatagcggtaagattttggttat |
226 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4642492 |
aacacaatgatgaagtgcatcgcggtaagattttggttat |
4642531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University