View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_low_46 (Length: 255)
Name: NF20300_low_46
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_low_46 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 43769444 - 43769183
Alignment:
| Q |
1 |
tcaaatgtaacttgcattttgttcagtatgttaagttttgaata-------acttacttggatagttactgcattgcctctgtcttgtcctttggctaaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43769444 |
tcaaatgtaacttgcattttgttcagtatgttaagttttgaatattgagtaacttacttggatagttactgcattgcctctgtcttgtcctttggctaaa |
43769345 |
T |
 |
| Q |
94 |
tttgcaatggattgcactgtcccaccattagacattatatcccactgtcataatgattattgtcaacacaaaaacacccctctaaattcatttacaaaat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43769344 |
tttgcaatggattgcactgtcccaccattagacattatatcccactgtcataatgattattgtcaacacaaaaacacccctctaaattcacatacaaaat |
43769245 |
T |
 |
| Q |
194 |
atgtttaatgactatgcacattaaccataatgtcatttgttatatcacttcctaaaatatct |
255 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43769244 |
atgtttaatgactatgcacattaatcataatgtcatttgttatatcacttcctaaaatatct |
43769183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 43779744 - 43779703
Alignment:
| Q |
3 |
aaatgtaacttgcattttgttcagtatgttaagttttgaata |
44 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
43779744 |
aaatgtaacttgcattttgttcaatatgttcagttttgaata |
43779703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University