View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_low_50 (Length: 227)
Name: NF20300_low_50
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 19347111 - 19347307
Alignment:
| Q |
14 |
gcagagataggattatactgtgaagtgtgtttcttgcatgatacacagtatttatatccttgaaaatgttcaaacccatagcaactttcagtaagtactc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19347111 |
gcagagataggattatactgtgaagtgtgtttcttgcatgatacacagtatttatatctttgaaaatgttcaaacccatagcaactttcagtaagtactc |
19347210 |
T |
 |
| Q |
114 |
tgtatcaatatcttgtagtgtagaagaaagcaagaagatatccttcattgcttgattcactaacaagttgtaactcaactccaaagtagaataagtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19347211 |
tgtatcaatatcttgtagtgtagaagaaagcaagaagatatccttcattgcttgactcactaacaagttgtaactcaactccaaagtagaataagtt |
19347307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 13503642 - 13503572
Alignment:
| Q |
140 |
aaagcaagaagatatccttcattgcttgattcactaacaagttgtaactcaactccaaagtagaataagtt |
210 |
Q |
| |
|
|||||||||||| |||||||||| | | | || |||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
13503642 |
aaagcaagaagagatccttcatttcatcactctctaatgagttgtaactcaattccaaagcagaataagtt |
13503572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University