View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20300_low_56 (Length: 216)
Name: NF20300_low_56
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20300_low_56 |
 |  |
|
| [»] scaffold0874 (1 HSPs) |
 |  |  |
|
| [»] scaffold1008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0874 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0874
Description:
Target: scaffold0874; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 462 - 640
Alignment:
| Q |
17 |
cacagagagggagtaattccattgcaggcaggagatatggaaaatatactcagaggagttcaaacaatgtttcacgaagggttagagatgcagattctga |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
462 |
cacaaagagggagtaattccattgcaggcaggagatatggaaaatatactcagaggagttcaaacaatgtttcacgaagggttagagatgcagattctga |
561 |
T |
 |
| Q |
117 |
agtttatgatatgggtttacaacaagatggaagttatcaattcttacagaatgagcaacctgactctacaagctggtaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
562 |
agtttatgatatgggtttacaacaagatggaagttatcaattcttacagaatgagcaacctgactctacaagctggtaa |
640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 2332380 - 2332202
Alignment:
| Q |
17 |
cacagagagggagtaattccattgcaggcaggagatatggaaaatatactcagaggagttcaaacaatgtttcacgaagggttagagatgcagattctga |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332380 |
cacatagagggagtaattccattgcaggcaggagatatggaaaatatactcagaggagttcaaacaatgtttcacgaagggttagagatgcagattctga |
2332281 |
T |
 |
| Q |
117 |
agtttatgatatgggtttacaacaagatggaagttatcaattcttacagaatgagcaacctgactctacaagctggtaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332280 |
agtttatgatatgggtttacaacaagatggaagttatcaattcttacagaatgagcaacctgactctacaagctggtaa |
2332202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1008 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: scaffold1008
Description:
Target: scaffold1008; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 3452 - 3279
Alignment:
| Q |
22 |
agagggagtaattccattgcaggcaggagatatggaaaatatactcagaggagttcaaacaatgtttcacgaagggttagagatgcagattctgaagttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452 |
agagggagtaattccattgcaggcaggagatatggaaaatatactcagaggagttcaaacaatgtttcacgaagggttagagatgcagattctgaagttt |
3353 |
T |
 |
| Q |
122 |
atgatatgggtttacaacaagatggaagttatcaattcttacagaatgagcaacctgactctacaagctggtaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3352 |
atgatatgggtttacaacaagatggaagttatcaattcttacagaatgagcaacctgactctacaagctggtaa |
3279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University