View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20300_low_58 (Length: 203)

Name: NF20300_low_58
Description: NF20300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20300_low_58
NF20300_low_58
[»] chr5 (1 HSPs)
chr5 (115-203)||(3952865-3952953)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 115 - 203
Target Start/End: Original strand, 3952865 - 3952953
Alignment:
115 tactatggttgtgaaattaagaaaaacataatcctgaataagtgggtatgggttcttgtcgatcaagaaatgaaaaccaaagtacgagt 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3952865 tactatggttgtgaaattaagaaaaacataatcctgaataagtgggtatgggttcttgtcgatcaagaaatgaaaaccaaagtacgagt 3952953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University