View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20301_low_9 (Length: 319)
Name: NF20301_low_9
Description: NF20301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20301_low_9 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 6 - 302
Target Start/End: Original strand, 22525 - 22821
Alignment:
| Q |
6 |
gtagattattcttcattctagtgaaatttgccccttatttccatatatttcttgccacattcgaaacattgttgtcaaacactctatgtttgtatttaat |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22525 |
gtagatttttcttcattctagtgaaatttgccccttatttccatatatttcttgccacattcgaaacattgttgtcaaacactctatgtttgtatttaat |
22624 |
T |
 |
| Q |
106 |
tgtcaaaacgccggctgaagtaaccacacccaacttcattgttattaggctaaatacaactagaataaacacaaacttagtcaccaacataaaggtttat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22625 |
tgtcaaaacgccggctgaagtaaccacacccaacttcattgttattaggctaaatacaactagaataaacacaaacttagtcaccaacataaaggtttat |
22724 |
T |
 |
| Q |
206 |
ccttcataaaatcaaaatgtaatcacttaccatccagtctcgagatttccataattttcgacctctattttgcaccattttttgttattgttagaag |
302 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22725 |
ccttcataaaatcaaaatgtaatcacataccatccagtctcgagatctccataattttcgacctctattttgcaccattttttgttattgttagaag |
22821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University