View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20302_high_7 (Length: 247)

Name: NF20302_high_7
Description: NF20302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20302_high_7
NF20302_high_7
[»] chr5 (2 HSPs)
chr5 (22-130)||(28147161-28147268)
chr5 (202-236)||(28147121-28147155)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 22 - 130
Target Start/End: Complemental strand, 28147268 - 28147161
Alignment:
22 gttgttaaagcttccaagtcgatatcaacgttaaaatatttaaattcaaacaaaaactatataaattctattggtattaccatcttcttggaacgttaac 121  Q
    |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28147268 gttgttaaagcttcgaagtcgatatcaacgttaaaatatttaa-ttcaaacaaaaactatataaattctattggtattaccatcttcttggaacgttaac 28147170  T
122 taatggtcg 130  Q
    |||||||||    
28147169 taatggtcg 28147161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Complemental strand, 28147155 - 28147121
Alignment:
202 taatctattcaatatgaaactcttaacacaggttc 236  Q
    |||||||||||||||||||||||||||||| ||||    
28147155 taatctattcaatatgaaactcttaacacatgttc 28147121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University