View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20302_high_7 (Length: 247)
Name: NF20302_high_7
Description: NF20302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20302_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 22 - 130
Target Start/End: Complemental strand, 28147268 - 28147161
Alignment:
| Q |
22 |
gttgttaaagcttccaagtcgatatcaacgttaaaatatttaaattcaaacaaaaactatataaattctattggtattaccatcttcttggaacgttaac |
121 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28147268 |
gttgttaaagcttcgaagtcgatatcaacgttaaaatatttaa-ttcaaacaaaaactatataaattctattggtattaccatcttcttggaacgttaac |
28147170 |
T |
 |
| Q |
122 |
taatggtcg |
130 |
Q |
| |
|
||||||||| |
|
|
| T |
28147169 |
taatggtcg |
28147161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Complemental strand, 28147155 - 28147121
Alignment:
| Q |
202 |
taatctattcaatatgaaactcttaacacaggttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
28147155 |
taatctattcaatatgaaactcttaacacatgttc |
28147121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University